EST details — SGN-E271419

Search information 
Request: 271419Match: SGN-E271419
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C64353Clone name: cLEM-5-O16
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E271419Length: 346 bp (922 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E271419 [] (trimmed) GAAAGTTTTTATATTTAGTGATCACTAAAGAAAAATCAAGAAGATGTCGACTACTGTAGGCCAAGTCATTCGTTGCAAAGCTGCTGTGGCATGGG
AAGCTGGTAAGCCATTAGTGATGGAGGAAGTAGATGTTGCTCCTCCACACAAAATGGAAGTTCGTCTTAAGATCCTCTATACTTCACTCTGTCAT
ACTGATGTATACTTCTGGGAAGCTAAAGGTCAAAATCCAGTCTTTCCTCGAATTCTTGGACATGAAGCATCAGGGATTGTGGAGAGTGTTGGAGA
GGGAGTAACAGACCTTGCACCACGAGACCATGTTCTTCCTGTCTTTACAGGGGAATGTAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E271419] SGN-U579420 Tomato 200607 Build 2 345 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T85224 [Download] [View] Facility Assigned ID: TGFAR92TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0227 Quality Trim Threshold: 14.5