EST details — SGN-E271581

Search information 
Request: 271581Match: SGN-E271581
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C62972Clone name: cLEM-23-L1
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C171689 [TUS-11-J7] Trace: SGN-T352143 EST: SGN-E551268 Direction: 5' Facility: Giovanni
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E271581Length: 589 bp (1043 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E271581 [] (trimmed) GCCCCGAGAAAAGAAGAAGAGGGAAAAATCCATAATACACCAAAATTAAATAAAATGTAGAAACCCCTAGCCTAGAATACCTCTCTTTCTCTCTC
TTTCAATATACCTTTCCCTCCAGACCTGTGGTTTCCTCCATGAAATGGGAAATGGAGGTGTATGAAATCGAAGCTGTTCTCGAGAAAATATGGGA
TTTACATGATAAACTTAGCGATGCCTATTCACTCTGTTTCTCGAGCTCAATTCCTCAATTCCGTCAAGTCTCGCTCTAAGTCCGATGACCTTTTA
CCGGTCACCCGTTCTAACAAGAGAAATGATAACAATGGAGATCAGGTAAAGCATGGTTCCGTTTTCGTTAAGGAGTTTCCTGTTGATGAGGATGA
ATCCCCTGTTCATGAGGCTAAGAGTCTCAATGCTATCCCGACCGCCCTTGAACCACCCTTGAGCCACCCAGCTCGAGTTCTTCCCTCCCGTACCA
AAATCAGCAACGTGCAGAAAGGGATGCTGCTCTTGCTCGCTTAGAGCAAAGCCCAATTGTACTTGCAATGCGATTGGCTGAACATCCAGGTAAGA
AATACAAATTCATTGAAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E271581] SGN-U569521 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T87109 [Download] [View] Facility Assigned ID: TGFDM61TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0175 Quality Trim Threshold: 14.5