Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E271763

Search information 
Request: 271763Match: SGN-E271763
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C65091Clone name: cLEM-8-E7
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E271763Length: 674 bp (837 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E271763 [] (trimmed) GAGGATCTTGTGGAACCGGCTACTCTCGCCTGGGCTGATCGCATTGGGGGTCACCGTCTCAACATGAGGAACGATTCTCGTCTTGAAGGCCTTAT
CAGGATGGCAGATCTGACCATCAATCTTGCTGCGATCTGCACTCCAGCTGATTACAACACTCGTCCACTTGATACCATTTACAGCAACTTCATTG
ATGCTCTTCCAGTGGTGAAGTACTGCTCAGAAAATGGAAAGCGACTTATTCATTTTTCCACCTGTGAAATTTATGGGAAAACAATAGGAGCCTTT
TTACCCAAAGACAGCCCACTGCGGCAGGATCCTGCATACTATGTGCTTAAGGAAGACACCTCCCCTTGCATTTTTGGACCTATTGAGAAGCAGAG
GTGGTCATATGCCTGTGCAAAGCAATTGATTGAGAGGTTGATATATGCTGAGGGTGCTGAGAATGGTTTAGAATTCACTATTGTAAGGCCGTTCA
ATTGGATTGGTCCTAGAATGGATTTCATTCCGGGCATTGATGGTCCTAGTGAAGGTGTTCCACGAGTGTTAGCTTGCTTTAGTAATAACCTCTTA
AGACGTGAACCGCTGAAATTAGTGGATGGTGGGGAATCACAGAGAACTTTTATATATATCAAGGATGCTATTGAAGCTGCTCTCTTGATGATTGA
AAATCCTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E271763] SGN-U580146 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T85314 [Download] [View] Facility Assigned ID: TGFBC28TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0032 Quality Trim Threshold: 20.5