Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E271833

Search information 
Request: 271833Match: SGN-E271833
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C65289Clone name: cLEM-8-O10
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C178390 is on microarray TOM1: SGN-S1-1-5.1.4.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178390 [TUS-29-A12] Trace: SGN-T1482 EST: SGN-E378763 Direction: 5' Facility: Giov. Lab
Clone: SGN-C178390 [TUS-29-A12] Trace: SGN-T183882 EST: SGN-E371553 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E271833Length: 498 bp (891 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E271833 [] (trimmed) GCTTCATTCCACCGATCCAGATCTCAAATCTCCGAGAGAGTGAAGAAGACGAAGAAGAAAATTGATTAGTAATGGCGGCCGTATCGCCATTAGCA
AAGTATAAGCTTGTGTTTTTGGGCGATCAATCTGTTGGAAAAACCAGCATCATTACTCGCTTCATGTACGATAAATTCGATACCACCTACCAGGC
TACCATTGGTATCGATTTTTTGTCCAAGACAATGTACCTTGAAGATCGTACAGTTCGCTTGCAGCTCTGGGATACTGCTGGTCAAGAGAGATTTA
AGAGTCTTATTCCCAGCTACATTAGAGATTCTTCTGTCGCTGTAATTGTGTTTGATGTTGCCAACCGTCAATCATTTCTAAACACTTCAAAGTGG
ATTGAGGAAGTACGTACTGAACGGGGAACTGATGTCATAATCGTTCTTGTTGGGAACAAAACTGATCTTGTTGAGAAAAGGCAAGTATCCATCGA
AGAAAGTGAATCCAAAGCTCGCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E271833] SGN-U579137 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T85384 [Download] [View] Facility Assigned ID: TGFBD89TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0048 Quality Trim Threshold: 14.5