EST details — SGN-E271876

Search information 
Request: 271876Match: SGN-E271876
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C65030Clone name: cLEM-8-B6
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C178228 is on microarray TOM1: SGN-S1-1-7.2.4.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E271876Length: 596 bp (980 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E271876 [] (trimmed) GCACAAGTGGTAGTCAATTTCAAAATGCCTGGGAAAGTGTACAATACTGCCATGTCTCCGGTGGCAACATCACACATGTTAATTGCTGCTGGAAC
TGAAGATGTTCAAGTTCGTCTTTGTGATATTTCTTCGGGTGCATTTGCTCATACATTATCTGGCCATCGTGATGGAGTAATGTCGGTTGAATGGT
CTGCTTCTAGTGAGTGGGTTTTGATAACAGGGGGATGCGATGGCGCGATTCGCTTTTGGGACATCAGGCGTGCAGGATGTTTTCGTGTTTTGGAT
CAGTCTCATAATCAGCTTGGAAGACGCCCATCTCTTCTTACACGATCCACTGCAAGCAAGGGTTCCACACTGAAACCATCTTCCGGAGGCCCAAA
TTCATCTGCAAAAGGCCGTCCATCTCATAAAAAAATGGGAAACAGTGCGAGTATCAAACACTCTGCAATTGCTAGACAAGTGAAGGGGTTTGGGA
AGCAGCGACTGCATCCAGGGATGCTCTCTAGTCAAGATAGAGCCACTGCTCATTATGGTGCTGTCAATGGATTAAAAGTGACCAATGATGGAATG
TATCTCCTTAGTGCAAGTTCTGATTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E271876] SGN-U569796 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T85427 [Download] [View] Facility Assigned ID: TGFBF03TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0121 Quality Trim Threshold: 14.5