EST details — SGN-E271882

Search information 
Request: 271882Match: SGN-E271882
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C65062Clone name: cLEM-8-D20
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C178251 is on microarray TOM1: SGN-S1-1-8.3.4.11
See unigene SGN-U585828 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C178251 [TUS-28-K17] Trace: SGN-T183242 EST: SGN-E370315 Direction: 3' Facility: INRA
Clone: SGN-C178251 [TUS-28-K17] Trace: SGN-T183243 EST: SGN-E370316 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E271882Length: 349 bp (970 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E271882 [] (trimmed) GCTTCTTCGAGGGCTGAAATATATACACACAGCCAATGTCTTTCACCGTGACCTGAAACCCAAAAATATATTAGCAAATGCTGACTGCAAGCTTA
AGATCTGTGACTTTGGTCTTGCAAGAGTGGCCTTCAATGATACTCCAACAGCTATATTTTGGACTGATTATGTTGCTACGAGGTGGTATAGGGCT
CCTGAATTGTGTGGATCATTTTTCTCTAAGTATACACCAGCAATTGATATATGGAGCATTGGATGTATATTTGCAGAACTACTGACTGGGAAGCC
TCTCTTTCCAGGTAAAAATGTGGTTCACCAATTAGACTTGATGACCGATCTGTTGGGCACACCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E271882] SGN-U585828 Tomato 200607 Build 2 32 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T85433 [Download] [View] Facility Assigned ID: TGFBF22TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0071 Quality Trim Threshold: 14.5