EST details — SGN-E271962

Search information 
Request: 271962Match: SGN-E271962
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C65045Clone name: cLEM-8-C4
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C178238 is on microarray TOM1: SGN-S1-1-5.3.4.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178238 [TUS-28-K4] Trace: SGN-T183372 EST: SGN-E370182 Direction: 3' Facility: INRA
Clone: SGN-C178238 [TUS-28-K4] Trace: SGN-T183373 EST: SGN-E370183 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E271962Length: 503 bp (895 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E271962 [] (trimmed) GCACAAACCTTACAAAAGCATCTTCTTTACGTTACACATTTGCCTTTCTGCCTGCCATCATTTTTTTTCCTCTCCAAATTATCAAAATTATTGCC
CCAGTTTCTCTCTGGTTTGGAACTGCATTTATCTATGGTTTAATTGAATTAATAAATTTTTTTTCTCTACTCTGTACCCGTCAATTTAAGTACAG
TTTCAGTTTTCGCAACAATTTTTTGGGATTTTGGCTCTGGCTTAGAGACATAACAAAAAGCGGTTATGGATCGAGAAGGAGGATCAGCCGGATCT
TGTTATTATTCAGTTCTAGGGGTACGCAACGACGCCTCCTGCTCCGACATTCGCTCAGCTTATCGGAAACTAGCTCTGAAATGGCACCCGGATAG
GTGGGCGAAGAATCCAGCGCTGGCCGGTGAAGCGAAACTCCGATTTCAGAAAATCCAAGAGGCTTATTCAGTTCTCTCCGATCAAGACAAGAGGT
CAATGTACGACGCCGGTTTCCTCGATAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E271962] SGN-U575113 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T85513 [Download] [View] Facility Assigned ID: TGFBD14TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0087 Quality Trim Threshold: 14.5