Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E272080

Search information 
Request: 272080Match: SGN-E272080
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C65272Clone name: cLEM-8-N14
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C178379 is on microarray TOM1: SGN-S1-1-8.1.4.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178379 [TUS-29-A1] Trace: SGN-T1483 EST: SGN-E378764 Direction: 5' Facility: Giov. Lab
Clone: SGN-C178379 [TUS-29-A1] Trace: SGN-T183747 EST: SGN-E370406 Direction: 5' Facility: INRA
Clone: SGN-C178379 [TUS-29-A1] Trace: SGN-T183812 EST: SGN-E370471 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E272080Length: 529 bp (984 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E272080 [] (trimmed) GAGCAAAAGAGCCAAGTGTTTCAACAATGTTGATGAACTTCAGTAATGATTTTGATCCTTATGGTGCCTTAAGTACCCCCTTGTATCAAACATCT
ACTTTTAAGCAACCTTCAGCGACCGAAAATGGGCAATATGATTATACACGGAGTGGAAATCCAACAAGGGATGCGTTGGAAAAGCTTCTTGCAGA
GCTTGAGAAAGCAGATCGAGCATTTTGCTTTACCAGTGGAATGGCCGCCTTGGCAGCTGTAACTCGTCTCGTCAAAGCTGGTGAGGAGATTGTTG
CCGGGGATGACATATATGGTGGTTCTGATCGGCTGCTCTCACAAGTTGTTCCAAAAGCCGGGATCGTGGTCAAGCGAGTGGATACCACTAATTTA
GATGAGGTTGCTTCTGTGATTAAACCACGGACAAAGCTTGTTTGGCTGGAAAGCCCAACCAACCCTCGTCAACAAATTTGTGATATTCGTAAAAT
AGCCAAGATCGCTCATGCACATGGGGCTCTTGTGCTGGTAGATAACAGCATTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E272080] SGN-U584762 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T85631 [Download] [View] Facility Assigned ID: TGFBF79TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0091 Quality Trim Threshold: 14.5