EST details — SGN-E272129

Search information 
Request: 272129Match: SGN-E272129
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C68312Clone name: cLEN-4-D21
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E272129Length: 607 bp (919 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E272129 [] (trimmed) GAAGATGGAAAGCCCTAGAGTTGAGGAGAGTTATGACAAAATGAGTGAATTAAAAGCGTTTGATGATACTAAGGCCGGTGTTAAAGGACTTGTTG
ATTCTGGAATTACTAAAGTACCTCAAATATTCGATCTACCGCCAAAAGACAGGGCTAAAAAATGTGAAACACATTTCGTTTTTCCAGTGATAGAC
CTTCAAGGTATCGATGAGGATCCGATTAAGCATAAGGAGATAGTGGACAAAGTTCGAGATGCATCGGAGAAATGGGGTTTTTTCCAAGTGGTTAA
TCATGGGATTTCAACATCCGTCTTGGACAGAACGTTGCAAGGAACACGACAGTTCTTTGAGCAAGATAACGAGCTGCAAGTTGGAGAGACACGAT
TTTCTGTTACATGGCTCCGAATCCTCCCAGTCTACAAGAATTTTCAACTCCATGCGGTTTAAATTTCTAGATCCGCCACTGCTCAGGTGATTGAC
TATCTAAAGACAGCAAAAATTCCTAGATCTGTCGCTGCTCAGTTGATTGAGTATCTAAATACAGCAAATTCTTAGATCCGCCATTGCTTAGTTGA
TTGACTATCTAAAGACGTCTGATTTTATATAAAAATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E272129] SGN-U577865 Tomato 200607 Build 2 30 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T88146 [Download] [View] Facility Assigned ID: TRRAO23TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0142 Quality Trim Threshold: 14.5