Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E272216

Search information 
Request: 272216Match: SGN-E272216
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C61855Clone name: cLEM-19-K7
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189393 [TUS-57-K23] Trace: SGN-T339333 EST: SGN-E538458 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E272216Length: 585 bp (915 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E272216 [] (trimmed) GGTTTCCTATTATGCTATTACTTGTCACCTCTTCTTTAACAATCCCTTCATATATTCACTTAATTCTACCAAAGTTGTCTGTTTTTTCACTTCTC
TGAATATGGGGCTTTGGGATTCTTTGCTCAATTGGCTTAGAAGCCTTTTTTTTAAACAGGAAATGGAGCTTTCCCTGGTAGGTCTTCAAAATGCT
GGGAAGACGTCTCTTGTCAATGCTATTGCTACTGGAGGCTATAGCGAGGACATGATTCCGACGGTTGGATTCAATATGCGGAAAGTTACAAAAGG
AAATGTGACCATAAAACTCTGGGATCTTGGGGGCCAAAGGAGATTTCGAACGATGTGGGAGCGCTATTGTCGGGGTGTCTCTGCGATATTGTATG
TTGTTGATGCTGCTGATAGAGACAGTGTACCTATAACAAGAACCGAGTTACATGAACTTTTGAAGAAACCTTCATTAACTGGAATTCCTCTGCTC
ATCTTGGGAAACAAAATTGACAAATCAGAAGCTCTTTCGCAGCAGTCATTGGTTGATCAACTAGGTCTCGACTCAATAACGGATAGAGAAGTCTG
CTGCTACATGATTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E272216] SGN-U584304 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T86214 [Download] [View] Facility Assigned ID: TGFCU64TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0060 Quality Trim Threshold: 14.5