Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E272248

Search information 
Request: 272248Match: SGN-E272248
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C61805Clone name: cLEM-19-I16
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C171664 [TUS-11-I6] Trace: SGN-T351497 EST: SGN-E550622 Direction: 5' Facility: Giovanni
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E272248Length: 447 bp (793 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E272248 [] (trimmed) GCTCAGAAAAGTTGCAGAAACTAAGGAAAAACAACGCTACCTTCTCCATATTTCTTCGGTTTATCAAATCGATAATCATCAAAATAAAGTATGAA
GTTTTAAAGTTTGTCAGATCACCAAATTATAGTACAGATTAGCTCTAATTTGGATCCTTCACGTTTCACTCACCAATTTCATCTGATTCGCTTTT
GGAGAAACGAAAAAAGGAGTGAAGAAGAAGAAGAGAAAAGGCGAAAGGCATAATGGGACAAGCTTTTCGCAAGCTATTTGATACTTTCTTCGGCA
ACTCTGAGATGAGGGTTGTGATGCTAGGGCTGGATGCGGCTGGGAAAACAACTATATTGTACAAGCTGCATATAGGAGAAGTTCTGTCTACAGTT
CCTACTATTGGTTTCAATGTAGAAAAAGTGCAGTACAAGAATGTGGGTTTTACTGTGTGGGACGTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E272248] SGN-U577084 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T86246 [Download] [View] Facility Assigned ID: TGFCV56TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0150 Quality Trim Threshold: 14.5