EST details — SGN-E272317

Search information 
Request: 272317Match: SGN-E272317
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C61747Clone name: cLEM-19-F20
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189387 [TUS-57-K17] Trace: SGN-T348933 EST: SGN-E548058 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E272317Length: 599 bp (843 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E272317 [] (trimmed) GAAGACTTTGTTTATGGATATGCTGGTGGAACAAACACACCATATATCTACGTTTGATCAGAATAGTGAGAAGCATATGAGGTATACAGACACAA
GAATAGATGAGCAAGAGAGGAGGATATCAATTAAGTCTGTCCCTATGTCACTAGTCTTGGAAGACAGCAATTCAAAGTCTTACCTGTGTAACATT
ATGGATGCTCCCGGCCATGTCAACTTCTCCGATGAAATGACTGCTGCTTTAAGACTTGCTGATGGGGCAGTTTTGATTGTTGATGCAGTTGAAGG
AGTGATGGTAAATACAGAAAGGGCCATTAGGCATGCGATTCTAGAACGTATTCCCATTGTTCTTGTAATCAACAAGGTTGATAGATTGATAACTG
AGCTTAAGTTGCCCCCGAAGGACGCCTACTTCAAACTAAAGCACATAGTTGAAACTGTCAACAGTCAAATTACAGCTGCCTCGTCCACCGCTGGA
AATGCACAAGTAATTGATCCTGCATTAGGGAATGTCTGCTTTGCAAGTGCAACAGCAGGATGGTCATTCACTCTGCAGTCATTTGCCAAACTGTA
TGTTAAGCTTCACGGAATTGCATTTGATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E272317] SGN-U571128 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T86315 [Download] [View] Facility Assigned ID: TGFCX34TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0041 Quality Trim Threshold: 14.5