EST details — SGN-E272946

Search information 
Request: 272946Match: SGN-E272946
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C63292Clone name: cLEM-25-A21
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189457 [TUS-57-N15] Trace: SGN-T339433 EST: SGN-E538558 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C189457 [TUS-57-N15] Trace: SGN-T339435 EST: SGN-E538560 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E272946Length: 443 bp (546 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E272946 [] (trimmed) GATTTGTGTCTGTAGCTGCTTTGGACTTGTGTCTGTGGCTATGACATTCTTGTAAAGCTTAGCTAAAGATTGAGCAGCCTGGCCACAAGTCCAAA
GCAGCTTGAATTTGCAGCAAAGGTTCCAAATGTTCAATACATATGTACCTCTCCTAAGTTGTCAAAATCCGAAATCGAAACAAAAATAGGATCAG
AATCAAGTGTAGATTTAGTAACAATTGCACAAGCAATGCATTGGTTTGATCTACCAACTTTTTATGAACATGTTAAATGGTTACTCAAGAAACCA
AATGGTGTTATAGCATCATGGTGTTACACTACACCTAAAATAAACAACTCAGTAGATGCAATATTTGATAAATTTTACACAAGTGATGCTGGACC
TTATTGGGAATCACCAAGAAAATTGGTCGATGAAAAGTATGAAACTATTGATTTTCCATTTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E272946] SGN-U580752 Tomato 200607 Build 2 98 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T87661 [Download] [View] Facility Assigned ID: TGFDS11TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.946 Expected Error Rate: 0.0014 Quality Trim Threshold: 14.5