Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E273020

Search information 
Request: 273020Match: SGN-E273020
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C63467Clone name: cLEM-25-L17
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C180984 is on microarray TOM1: SGN-S1-1-3.1.17.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E273020Length: 576 bp (991 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E273020 [] (trimmed) GCACTGATGAACAGTCAAGAACTTGTTTGGGGTTGAAGTATAGTTGATTCTTGAAAATACCCAATTTGCAAAAACTTGTTTTGGGTTGAGGGGTA
GTTGATTCTTGAAAAATACCCAATTTGCTAAGAACTTGTTTGGGGTTGAGGGGTAGTTGATTATTGAAAAATACCCAATTTTGCTAAAAAGTTGT
TTGGGGTTGAGGGGTAGTTGATTATTGAAAAATACCCAATTTGCAGTTGGGGGTATAGAGGGAGATGGTGGAAAGTTCAGTTGGAGGGGTGGTGC
CAGCAGTGAAGGGGGAGGTGATGAGGAGGATGGGGGACAAAGAGGAGGGGGGTAGTGTAACTCTAAGGGATGAAGAAGTTGGGACAGTGACAGAA
TGGGAATTGGACAGGGAATTGTTGTGTCCTATATGTATGCAGATCATAAAGGATGCATTTTTAACAGCTTGTGGGCACAGTTTTTGCTATATGTG
CATAGTTACTCATCTTCACAACAAGAGTGATTGCCCCTGTTGTTCTCATTATCTCACTACCAGTCAACTCTATCCCAATTTCCTACTTGACAAGC
TATTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E273020] SGN-U579490 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T87735 [Download] [View] Facility Assigned ID: TGFDU69TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.931 Expected Error Rate: 0.0036 Quality Trim Threshold: 14.5