EST details — SGN-E273234

Search information 
Request: 273234Match: SGN-E273234
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C63201Clone name: cLEM-24-K17
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: This clone is not found on any microarray
See unigene SGN-U573418 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E273234Length: 403 bp (1053 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E273234 [] (trimmed) GCCAAAATCTCAAAAATTAGTAAGAAGAGAGATCAGGAAGCAACAAATAAGGATGAAGGGTGGTACAGTTCAGATCAATTGGCACGACAGTAAGC
CAGTTTTGTGCCTTGATTTTCACCACCTCACCGGCGTTATTGCTACTGGTGGCGCCGACTATGATATCAAGATGTGGGTGATTGATTCTGAAGAA
AATGAAAAGAAAGCGCCTTCAGTTACATACCAGGCTAGCCTTTCTTACCATAGTGGTGCTGTGAATGCTCTTCGGTTCTCCCCTTCAGGAGAGCA
TTTGGCCTCTGGTGCCGATGGCGGCGAGCTCATCATTTGGAAGCTACATTCTTCAGATGACAGCAAAACATGGAAAGTCCTAAAGACGTTATCAT
TTCACCGGAAGGATGTATTGGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E273234] SGN-U573418 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T87440 [Download] [View] Facility Assigned ID: TGFDO69TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0078 Quality Trim Threshold: 14.5