EST details — SGN-E273449

Search information 
Request: 273449Match: SGN-E273449
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C68177Clone name: cLEN-3-H7
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189498 [TUS-57-P8] Trace: SGN-T339493 EST: SGN-E538618 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C189498 [TUS-57-P8] Trace: SGN-T348961 EST: SGN-E548086 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E273449Length: 539 bp (910 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E273449 [] (trimmed) TTTTCCTTATGTCAAGATAATTTCTGCTGAAACTATGATTGGGCTCAGCGAAAGCAGCAAATGTTCTCAGATAGTCAAGGTATTTGAGGATGCAT
ACAAGTCACCACTTAGTATAGTGGTCCTTGATGGGATTGAAAGACTTCTGGAATATGTTCCAATTGGCCCTCGATTTTCAAATTTGATTTCTCAA
ACGCTTATGGTGCTTCTTAAACGGCTTCCTCCTAAGGGTAAAAAGATTCTTGTGATTGGAACTACTAGTGAATCCGGTTTCTTGGAGTCAGTTGG
CCTTTCTGATGCCTTCTCAGTCACATACCATGTTCCAACACTGAAGACAGAAGATGCCAAGAAGGTGTTGCAACAACTTGATGTCTTTGCAAGCG
ATGACGTTGATTCTGCTGCTGAGGCCTTAAATGATATGCCCATCAAGAAACTCTACATGGTTGTTGAAATGGCTGCACAGGGTGAACACGGTGGG
ACAGCAGAAGCCATCTATTCTGGCAAAGAAAAGATTAATATCGCACATTTCTATGATTGCCTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E273449] SGN-U569935 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T88045 [Download] [View] Facility Assigned ID: TRRAK40TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0070 Quality Trim Threshold: 14.5