EST details — SGN-E273575

Search information 
Request: 273575Match: SGN-E273575
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C68466Clone name: cLEN-6-H18
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189512 [TUS-57-P22] Trace: SGN-T339517 EST: SGN-E538642 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C189512 [TUS-57-P22] Trace: SGN-T348965 EST: SGN-E548090 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E273575Length: 495 bp (880 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E273575 [] (trimmed) CATCATTTTTATGGCTGTCGAGGTTGTCGGAGGTATTAAAGCCAACAGTCTTGCAATTTTGACGGATGCGGCTCATCTATTGTCAGATGTTGCAG
CTTTTGCAATATCCTTGTTTTCACTCTGGGCATCACGATGGGAGGCTAATCCACGCCAGTCCTATGGGTTTTTTAGAATTGAGATACTTGGGGCA
CTAGTTTCTATCCAAATGATATGGCTTCTAGCTGGGATCCTTGTTTACGAAGCCATTGCTCGACTTATACATGATACAGGTGAAGTTCAAGGTTT
CCTCATGTTTGTGGTGTCTGCATTTGGATTAGGAGTGAACCTCATCATGGCACTCTTGCTAGGTCATGATCACGGACACGGTCACGGTCATGGAC
ACAGCCACGGTCATGACCACGGCCATGAACACAGTCATAGTCATGAAGAGCATGCTCATAGCCACGGTGATCATGAACATGCCCACTGTGAGCAT
AAACATATACATGGAATTAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E273575] SGN-U573562 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T88271 [Download] [View] Facility Assigned ID: TRRAX45TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0227 Quality Trim Threshold: 14.5