Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E273901

Search information 
Request: 273901Match: SGN-E273901
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C68597Clone name: cLEN-7-B21
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C171792 [TUS-11-N14] Trace: SGN-T352380 EST: SGN-E551505 Direction: 5' Facility: Giovanni
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E273901Length: 403 bp (729 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E273901 [] (trimmed) CGATTCAGAAAAGATCAGGTCGTCTATGAACGAAAGAAGAATGCAGAAGATACCTGCATATAGTTGGATAGAGATTGATGGAATAGTTCATGAGT
TTCTTGTTGGAGATACATACCATCCAATATCAGATAACATATACGTCAAACTCGGTGAACTGAGCAAGGAGCTAAGAGAGGTAGGTTATGTTCCA
AGAACAGAATACGTTCTATTTGACATCGAAGAGGAGGAGAAGGAGCATTTCGTGGGGTGTCATAGTGAGAAGCTCGCGCTTGCATATGGCTTACT
AAGTACGAAACCTGGTGATGGTATCAGGATAATAAAGAATCTTCGTATCTGTGGTGATTGCCATACGTTCTTCAAGCTTGTCTCAATGATAACGG
GGAGAGAAATTATCTTACGAGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E273901] SGN-U572790 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T88597 [Download] [View] Facility Assigned ID: TRRBA11TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0135 Quality Trim Threshold: 14.5