EST details — SGN-E273932
Search information |
Request: 273932 | Match: SGN-E273932 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C68807 | Clone name: cLEN-7-N3 |
| ||
Library Name: cLEN | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: fruit pericarp
Development Stage: red ripe to over-ripe
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E273932 | Length: 203 bp (733 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E273932 [] (trimmed)
GGGGTCTCAGCTAGATAGTCTAAAATCTGTGACCAATTTTGACATAAGCAATAACAATATGGGGAGCCAGATACCTTACCAGCTTCCTCCAAATG
TGCAAAGACTAAACCTTGCTTCTAGTGGTTTTAGTGGTGGCCTCCCATATTCCATTTCACAGATGACCTCCCTCCAGTACTTAAATGTCAGTCAC
AATCAAATTCAAG
TGCAAAGACTAAACCTTGCTTCTAGTGGTTTTAGTGGTGGCCTCCCATATTCCATTTCACAGATGACCTCCCTCCAGTACTTAAATGTCAGTCAC
AATCAAATTCAAG
Unigenes |
Current Unigene builds | |||||
[SGN-E273932] | SGN-U571991 | Tomato 200607 | Build 2 | 12 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T88628 [Download] [View] | Facility Assigned ID: TRRBA74TH |
Submitter: Koni | Sequencing Facility: TIGR |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.945 | Expected Error Rate: 0.0001 | Quality Trim Threshold: 12.5 |