Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E274031

Search information 
Request: 274031Match: SGN-E274031
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C68920Clone name: cLEN-8-F1
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E274031Length: 423 bp (843 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E274031 [] (trimmed) CAGTAGAGGAGAGAATTGGGACAGCAGATAGAAGAAAGATGGATGGAAATGCTTTATTTAAGGAAGAGAAACTGGAGGAAGCTATGCAACAGTAT
GAAATGGCCATTGCATATATGGGAGATGACTTCATGTTTCAGCTGTTCGGTAAGTTCCGGGACATGGCTTTAGCTGTAAAGAATCCCTGCCATCT
GAACATGGCAGCCTGCCTGCTGAAGCTCCAGCGATATGATGAAGCCATTGCACAATGTAGCATTGTCCTAGCAGAAGAAGAAAACAATGTAAAAG
CGTTGTTTAGGCGTGGAAAGGCTAGGTCTATACTTGGTCAGACTGATGCAGCTCGTGAGGACTTCCTTAAAGCACGTAAGCTTGCTCCACAAGAT
AAAGCCATTACAAGGGAATTGAATTTGATTGCAGAACACGAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E274031] SGN-U576282 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T88727 [Download] [View] Facility Assigned ID: TRRBE25TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0172 Quality Trim Threshold: 14.5