EST details — SGN-E274274

Search information 
Request: 274274Match: SGN-E274274
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C66737Clone name: cLEN-15-H21
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189589 [TUS-58-D3] Trace: SGN-T339652 EST: SGN-E538777 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E274274Length: 274 bp (853 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E274274 [] (trimmed) TATAAAAAGTTTTCATATTTAGTGATCACTAAAAAAAAATCAAGAAGATGTCGACTACTGTAGGCCAAGTCATTCGTTGCAAAGCTGGTAAGCCA
TTAGTGATGGAGGAAGTAGATGTTGCTCCTCCACAGAAAATGGAAGTTCGTCTTAAGATCCTCTATACTTCACTCTGTCATACTGATGTATACTT
CTGGGAAGCTAAGGGTCAAAATCCAGTCTTTCCTCCAATTCTTGGACATGAAACACCAAGGATTGGGGAAAGGGTTGGAAAGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E274274] SGN-U577316 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T90509 [Download] [View] Facility Assigned ID: TRRCG47TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0054 Quality Trim Threshold: 14.5