Notice: The contact form functionality has been restored. Apologies for any inconvenience.

EST details — SGN-E275064

Search information 
Request: 275064Match: SGN-E275064
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C69199Clone name: cLEN-9-G1
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: Alias clone SGN-C180763 is on microarray TOM1: SGN-S1-1-8.4.17.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180763 [TUS-35-D9] Trace: SGN-T193923 EST: SGN-E392597 Direction: 3' Facility: INRA
Clone: SGN-C180763 [TUS-35-D9] Trace: SGN-T193924 EST: SGN-E392598 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E275064Length: 490 bp (861 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E275064 [] (trimmed) ATTAAACTCTATTATTCATTTTGATTCTTTGAAAATTTTTGAGTGTTTAAACAAACAAAGACACTCAATCTCTTTGCTTCATTCTAAAAGAGAGA
TCTTTTTTAAGAATTAGAAAAAGAAAAGAACCTTTCTTAGCTTGTAGATATCCGATCCCCTTCTTGAAATTCTGGGGGAAAGCTGATTGTTTAAG
GCATCACTGTCTCTGTTACATCAAAAAATAATTAAAAAGTGGTTTTTAGCTGATATTGGGTACATAAGAATGGGAGATCACTTTGTGTTTCTGGT
TGATCGGGTGCTAACTGAATCCAGTTTGGAGGCTGCAATTCAAAGTAGAGACCCGAAACTGCAACCATCATCGATAACAAAAAGCTCGGGAACTG
ATTGCTCTTCCCAGGATTCTGATCCTCTGAGTCCTAGGAAGATGGTCGAATGCAGGATATGCCAAGATGAAGATGTGGATTCAAATATGGAAGTT
CCTTGCTCTTGCTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E275064] SGN-U567045 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T88936 [Download] [View] Facility Assigned ID: TRRBG37TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.941 Expected Error Rate: 0.0301 Quality Trim Threshold: 14.5