EST details — SGN-E275199

Search information 
Request: 275199Match: SGN-E275199
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C69101Clone name: cLEN-9-A11
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: Alias clone SGN-C180729 is on microarray TOM1: SGN-S1-1-2.2.17.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E275199Length: 606 bp (867 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E275199 [] (trimmed) CGGTGCTACTCGTTCCGCTATTAACTATCAACTTTCCAGCGGAGTTGCTAATGCTGTAGCACATCGAGGTTTACCTATCAACATTGCTTCTGCTC
CATCAACATCTACAGGTGCTACTCATTCCGCTATTAACCATCAACTTTCCAGCGGAGTTGCTAATTTACCTATCAACATTGCTTCTGCTCCATCA
GCATCTACTAGTGCTGCTCATTCTGCTACTAACTATCAACTTCCCAGTGAAGTTGCCAATTCTGTGGCACATGGTTCTAATAATTTCAATTCAGT
TCAACACAACTCAATCTTCACATCACTTCTTCAATGCTCACAAAAATACCAATTTGGGTCGAAAGAACCACAACCATTCCAAATGCCATCAAATA
ACATTGTCTCCCAGTTCCAAATGCCATCAAATAGCATTTCTCAATTCCAAATGACATCAAGTTTGAACAACAGCACCCAGCATGGATATCTTCTG
AGTGAGCTTCCCAATCTGATTTCTGAAGAACAAGCAGCAACCACATCGTCCATGAACGAGAGCCGTATCAATGCAACAAATTTTCATGGCGATAA
TTTGCGGGAAGCAGTCAATGCAACAAATTTTCATGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E275199] SGN-U568669 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T89071 [Download] [View] Facility Assigned ID: TRRBG06TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0062 Quality Trim Threshold: 14.5