EST details — SGN-E275458

Search information 
Request: 275458Match: SGN-E275458
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C65614Clone name: cLEN-10-L4
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: Alias clone SGN-C180815 is on microarray TOM1: SGN-S1-1-4.2.17.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180815 [TUS-35-F13] Trace: SGN-T196388 EST: SGN-E395062 Direction: 3' Facility: INRA
Clone: SGN-C180815 [TUS-35-F13] Trace: SGN-T196389 EST: SGN-E395063 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E275458Length: 524 bp (835 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E275458 [] (trimmed) GAATCAGAGAACATTCCGTCCCAAAAAGAGTGCACCCTCAGGGAGTAAGGGTGCACAATTAAGACAGCACATTGATTCTACTTTAGGCAGCGGAA
ACTTGAGAGAGGCTGTAAGGCTTCCTCCTGGGGAAGATATTAATGAATGGCTAGCTGTCAACACTGTAGATTTCTTCAACCAGGTGAATCTGCTT
TATGGCACCCTCACTGAGTTCTGTACACCAGAAAACTGCCCAACAATGACTGCAGGCCCCAAGTATGAGTATAGGTGGGCTGATGGTGTACAAAT
CAAGAAGCCTATTGAAGTTTCTGCTCCGAAATATGTTGAATATTTGATGGACTGGATTGAAACTCAATTGGATGATGAATCTTTATTTCCTCAAA
GGCTTGGTGCACCTTTTCCACCTAACTTCAAGGATGTTGTCAAGACGATATTCAAACGTCTCTTTCGTGTATATGCACATATCTATCACTCCCAT
TTTCAGAAGATCGTGAGTCTTAAGGAGGAAGCACATTTGAATACGTGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E275458] SGN-U580589 Tomato 200607 Build 2 25 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T89330 [Download] [View] Facility Assigned ID: TRRBN62TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0039 Quality Trim Threshold: 14.5