EST details — SGN-E275635

Search information 
Request: 275635Match: SGN-E275635
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C67360Clone name: cLEN-18-G21
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: Alias clone SGN-C183027 is on microarray TOM1: SGN-S1-1-8.2.3.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183027 [TUS-41-B17] Trace: SGN-T195619 EST: SGN-E394293 Direction: 5' Facility: INRA
Clone: SGN-C183027 [TUS-41-B17] Trace: SGN-T195810 EST: SGN-E394484 Direction: 3' Facility: INRA
Clone: SGN-C183027 [TUS-41-B17] Trace: SGN-T195810 EST: SGN-E398844 Direction: 3' Facility: INRA
Clone: SGN-C183027 [TUS-41-B17] Trace: SGN-T199443 EST: SGN-E398117 Direction: 3' Facility: INRA
Clone: SGN-C183027 [TUS-41-B17] Trace: SGN-T200143 EST: SGN-E398845 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E275635Length: 646 bp (900 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E275635 [] (trimmed) CGAAAAATCATTTTTTAGAAATCCATTTTTCATATATATAATTTTTTTAAAATGAGTCTATTTGGTCTTGGAAGGAATCAGAGAACATTCCGTCC
CAAAAAGAGTGCACCCTCAGGGAGTAAGGGTGCACAATTAAGACAGCACATTGATTCTACTTTAGGCAGCGGAAACTTGAGAGAGGCTGTAAGGC
TTCCTCCTGGGGAAGATATTAATGAATGGCTAGCTGTCAACACTGTAGATTTCTTCAACCAGGTGAATCTGCTTTATGGCACCCTCACTGAGTTC
TGTACACCAGAAAACTGCCCAACAATGACTGCAGGCCCCAAGTATGAGTATAGGTGGGCTGATGGTGTACAAATCAAGAAGCCTATTGAAGTTTC
TGCTCCGAAATATGTTGAATATTTGATGGACTGGATTGAAACTCAATTGGATGATGAATCTTTATTTCCTCAAAGGCTTGGTGCACCTTTTCCAC
CTAACTTCAAGGATGTTGTCAAGACGATATTCAAACGTCTCTTTCGTGTATATGCACATATCTATCACTCCCATTTTCAGAAGATCGTGAGTCTT
AAAGAGGAAGCACATTTGAATACGTGCTTCAAGCATTTCATTCTCTTCACCCATGAATTTGGGTTGATTGACAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E275635] SGN-U580589 Tomato 200607 Build 2 25 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T91064 [Download] [View] Facility Assigned ID: TRRCQ47TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0058 Quality Trim Threshold: 14.5