EST details — SGN-E275996

Search information 
Request: 275996Match: SGN-E275996
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C66095Clone name: cLEN-12-L24
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E275996Length: 632 bp (1038 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E275996 [] (trimmed) GCTAGGTGCTGCAGAAGCTGAGATTGCTGAGCTGAGACAGAAGTTAGATGCTTCTAAAAGGGAACGGTCTAGACTCTCGGAAGTCTTGAAGTCTA
AGCATGAAGAAACCGAGGCCTACCTCTCTGAGATTGAGACAATTGGGCAGGCCTACGATGATATGCAAGCTCAAAATCAGCAGCTTTTCCAGCAA
ATCACAGAGAGAGATGATTACAATATAAAGCTTGTTTTAGAAGGAGTACGGGCAAGACAACAGCGGGATTGTTTGGCTTGGGAAAGTCAAATCAC
AGAGAGAGCAGTTGAAGATGCCAATACAATGGTCAGTTCCTATGAAATGAAAGCTGCCAAAATTGATGACCAGTTGAGGGGATGCTCAGACTTGA
TCCAGAAGCTTGCTGAAGATAGGGGTCAGAATTCTCTTGCTTTAGAGAACACCCAAAAACGGTTTTTAGATGTAAGAAAATCTTCCCAGCAATTG
CGGGAGACGCTGGAAGAATGGCAATCCAAGATCGACGAAGTTCGAGTTGATCTTGCACAGTTGCAGATAGAACTAGAGAAAGAAAGGTTTGAGAG
AAAAAGAGCAGAGGAGGATGTAGAAGCTCTGAGGAGAAAGACTTCACGTTTGAGATCACACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E275996] SGN-U565040 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T89820 [Download] [View] Facility Assigned ID: TRRBV72TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0107 Quality Trim Threshold: 14.5