EST details — SGN-E276500

Search information 
Request: 276500Match: SGN-E276500
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C67019Clone name: cLEN-17-C23
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E276500Length: 557 bp (949 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E276500 [] (trimmed) ATTGTTTAACGACAAGATATGCGGTTGGAGTTCACCGCATCAGGGATGCAGAGAGGTCCCAGAATCCCAATGAGCAGCTCTCATGGGCTGGTATT
GAGATGGCCTCAATACTAAGAGAAGGAGATTCTACTTCGATAGAGCCTCCAGTAGCATGGGCTGGTCTCGCCATGGTCCACAGGGCCCAACATGA
AATTGTGGCAGGATTTGAAGTTGAGCATAATGAATTGGTGGAAGTCAAGGAGCATGCTATCTATAGTCTAAAGCAGGCAATAGCCGAAGATCCTG
CTGATGCTGTTCAATGGCATCAGCTTGGCCTTCATAGTCTGTGTACCCAACAATTTAAGACGTCTCAAACGTACCTCAAAGCTGCAGTTGCACGC
CGTAAGGACTGCACCTATGCCTGGTCAAATCTTGGTATTTCACTGCAACTATCCGAGGAGTCTTCTCAAGCTGAATCGGTGTATAAACAAGCATT
GTCACTAGCTACACCAAAACAAGCGCACACAATATTTTCAAACCTTGGAAATCTCTATCGGCAGCTAAAACAGTATGAATGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E276500] SGN-U585351 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T90921 [Download] [View] Facility Assigned ID: TRRCM24TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.987 Expected Error Rate: 0.0076 Quality Trim Threshold: 14.5