EST details — SGN-E276594

Search information 
Request: 276594Match: SGN-E276594
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C67001Clone name: cLEN-17-B24
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: Alias clone SGN-C181051 is on microarray TOM1: SGN-S1-1-8.4.17.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181051 [TUS-35-P9] Trace: SGN-T196427 EST: SGN-E395101 Direction: 5' Facility: INRA
Clone: SGN-C181051 [TUS-35-P9] Trace: SGN-T197736 EST: SGN-E396410 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E276594Length: 619 bp (901 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E276594 [] (trimmed) TTTCTTAAGTGTTTGGTTGTGTCTGTTTTGTTCATGTTCCTCATGTTAGACGTGACAAACTTGACAAGAAGGCAATCGGCAATCATAGGCATCCA
TGTGGCTTACAGTGAAGTTTCTAAAGCCTACAAGGTCTATCATCCTCAGACAAAGAAGATGACAATTACAAGAGATGTTCATTTTAGTGAGAATG
AATAGTGGGACTGGAAGAACTCTCATAAATCAGGAAGTCGCTCTCTAGAAGCAAACATCAGTCCTCCTGAAGAGCAAAAAACAGAACACTGGCAG
CAAGAACTAGAAGATGATCATCCAGTCAAGGGGAGGAGGTTGTTGTCAGATATCTATCAGAGGTGTAATGTCGCCATCTATGAACCTGCTGGTCC
CGTAGAAGCTTTGCAAGACCCAAAATGGAAGAAAGCAATGGAGGAGGAGATCTCCATGATTGAGAAAAATAAAACTTGGGTGCTGGTAAACAAAC
CTGAAGATAGAAAAGTCATTGGTGTGAGATGGGTCTTCAGAACAAAGTTAAATGCAGATAGTTCCATCAACAAATACAAAGCGAGGCTTGTAGTT
AAAGGGTATGCACAAATTTATGGTATTGATTACTCTGACACTCCTGTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E276594] SGN-U576392 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T91015 [Download] [View] Facility Assigned ID: TRRCP12TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0072 Quality Trim Threshold: 14.5