EST details — SGN-E276656

Search information 
Request: 276656Match: SGN-E276656
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C66562Clone name: cLEN-14-K5
cartOrder Clone
Library Name: cLENOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: red ripe to over-ripe

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E276656Length: 536 bp (774 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E276656 [] (trimmed) TGACAGAACATTTCTCCCCTGCACACACAGCGAATCCAACTTTTTTTCTCTCACAAACTCCATTAAACTCGTAAAATAATTCATCCAGTTCTATC
TTATTTCTTTAAATCTCTTATTTTTGGTTCTGTTTAAACATAATATATATATATTTATTTATTTTCGTTCAAGCTAAAAGTCAAATCTTATTGAT
ATATCACTCTTTGTACCTTTGGAATTTTGTAGACTGGTGGATCGGTGGTTGTGAATATCAAGATTTTTAGGAGGGGTTATGGTACACGTTGCTTA
CTATAGGAGGCAGCTTAGGTGTGACTGATTATATGGATAATTTATGCTGCTTTAATTCAAAGTTCTCGAAGCTTGCAGGAGGACGGTCATCATGT
AGCTCTGGCAAAGGAAGAAGCAATCAAGGGCCTACCAAGTATGGCTTCAGCCTGGTTAAGGGGAAAGCTAATCACCCCATGGAAGATTACCATGT
TTCTAAATTTGTCCAATTGCATGGACATGAACTAGGACTCTTTGCTATTTATGATGGGCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E276656] SGN-U580176 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T90202 [Download] [View] Facility Assigned ID: TRRCA63TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0119 Quality Trim Threshold: 14.5