EST details — SGN-E277196

Search information 
Request: 277196Match: SGN-E277196
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C58798Clone name: cLEL-3-L12
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C58798 [cLEL-3-L12] Trace: SGN-T21431 EST: SGN-E277310 Direction: 3' Facility: Novartis
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E277196Length: 273 bp (1337 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E277196 [] (trimmed) ATATGGGTGATTATTCTCAATAAACTAATAGTCATAGCCAATGTCAAGAATTGAATAACAGATGTGCAGCTCGCATGAACTTAAAGTTCCAATGC
CAAAATTTTGTTTTAAGTTATGATGGCACAAGTGTATAACCAAATAACCTCATACTTGATATCGTTCTAGAAAACAATACATCATCGGATGGAGG
CGAAAATAACAAAAAACAGAAACAACACCACGCTAAGGAAAACATCTCTCCACTAAACTGATGAACATTTATGCGTGTATCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E277196] SGN-U567173 Tomato 200607 Build 2 27 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T21432 [Download] [View] Facility Assigned ID: tomato030466.x
Submitter: Koni Sequencing Facility: Novartis
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.930 Expected Error Rate: 0.0133 Quality Trim Threshold: 14.5