EST details — SGN-E277219

Search information 
Request: 277219Match: SGN-E277219
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C58698Clone name: cLEL-3-C21
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E277219Length: 395 bp (1170 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E277219 [] (trimmed) ACAAAAGTGACATGGTATTGAAATGCAGAATCCATATGAACCTCATTTATTGAACTAGTACTAGTAGTTGTGATAATTAAGTAAACCATCAGAGC
TTGTTGAGGATTATCTGAGCACCATACTGAGGCTTCATAACGAGTATTGCCTGAGGGGCATGAACATAGGAAGGAGAGAGCTTGAACCAAAACCT
CTGCAGAATTTGAGATAAAACGAGCTTTGCTTCTGCCATTCCAAAGTTATTACCAATGCACATTCGAGGACCCCAACCGAAGGGGAAATACAATG
GCTCTTTTGCAGCTTTGGATACCCCTTCTGAGAACCTATTTGGATTGAAAATCAGTGCATCGTCTTCCCATACTTGGGGGTCGCGATGTGCTATG
TATATAGGCACAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E277219] SGN-U578058 Tomato 200607 Build 2 108 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T21261 [Download] [View] Facility Assigned ID: tomato030123.x
Submitter: Koni Sequencing Facility: Novartis
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0142 Quality Trim Threshold: 14.5