EST details — SGN-E277254

Search information 
Request: 277254Match: SGN-E277254
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C58744Clone name: cLEL-3-G22
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E277254Length: 421 bp (609 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E277254 [] (trimmed) CAGATTTAAGGAAATTGCCGCTGCCGTTGCCCGGCAATCATGTCCGATGTGCCTCTGCCAGATACACCATCGGACCGCGGCGGTTGTTATCCCAT
GTATGCACGCCTACTGCATCGTTTGCATCCGCAGATGGAGCGATGTGAAGAGAAAATGCCCTCTCTGCAACGCCGACTTTGATTCATGGTTCTCC
AGAATCAGCTTCTCCTCCCGGACCTTCCAGAAAGAGCAATTATCAGCTCGTAACGAGACTAAGAAGTTACACTCAGGTTTTGTTCCCTCTAGGCT
GAGAGACCGATTGGCGGACCGAAGAGTGATTAGGAGAAGGAGAGAAGAGTTGAATACTTTTGGCTCCAGAACGAGGCCGTTCCCAAGGCGGCGAT
CCTTTGATCACAAAGGAGCTATGAATCCAGATGATATTACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E277254] SGN-U574457 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T21321 [Download] [View] Facility Assigned ID: tomato030247.t3
Submitter: Koni Sequencing Facility: Novartis
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.988 Expected Error Rate: 0.0066 Quality Trim Threshold: 14.5