| SGN ID: SGN-C58798 | Clone name: cLEL-3-L12 |  | Order Clone |
|
| Library Name: cLEL | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Sequence Id: SGN-E277310 | Length: 280 bp (790 bp untrimmed) |
| Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E277310 [] (trimmed)
CGGCACGAGGTCACCGCAAGCACAAACCCTACGCGTCCTCTCACTCAATTAACCGAGCCCCATGGATATTGAAGAGGACATGAGGGCGCTGCAGC
TTGATTCATCTGAAGATCCTGTGTTGGTCAACGTGGAAGATGCTAGACCTGGTGAAGCTATAAAACATGATAAAGTTGATGGAGAGGATAGTTTT
ATGGAAGAAGAGAGGAAGACTGATGATGTTGGGAAACCTGATATGCCGGAAGATGGTAGAGTTAAGAGATGAAGCACATTCAGACTTAAA
[BLAST] [AA Translate]
| SGN-ID: SGN-T21431 [Download] [View] |
Facility Assigned ID: tomato030466.t3
|
| Submitter: Koni |
Sequencing Facility: Novartis |
Funding Organization: National Science Foundation
| Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
| Sequence Entropy: 0.974 |
Expected Error Rate: 0.0187 |
Quality Trim Threshold: 14.5 |
