EST details — SGN-E277982

Search information 
Request: 277982Match: SGN-E277982
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C73439Clone name: cLER-4-M6
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189703 [TUS-58-H21] Trace: SGN-T339845 EST: SGN-E538970 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C189703 [TUS-58-H21] Trace: SGN-T349019 EST: SGN-E548144 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E277982Length: 380 bp (774 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E277982 [] (trimmed) CTGCCGTAGAGTTCACCCTTTCTCAATCTACAATAACAACAAGAAGAAGAACCCAGCAAACCCTTTAATCACCAGTTTCTCAGTTCGTCAACTAT
ACTAAGGTGGGCTACAATGGCAACATCAGGAGTAGCTGCTAGTCCCATAAAATACTGTCTCCAATTACCTGTACAATGTCCAGGGTTGCGTGAGA
AGAGAGTTTCAGTTTCTAACTTAGGGAGATCAAGTCATTGTACTGTTTCTACACAGAAGTATCACCCAAGAAGAATGCCTTTAGTGAAGTGTGCA
ATGGAAGCTTCTTTTGGTGGTTCTACAGATGACTCTGCTGCTATCTTTCCGAGAATTAATGTGAAGGACCCATACAAACGACTTGGAATCAATAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E277982] SGN-U563193 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92815 [Download] [View] Facility Assigned ID: TPRAN75TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0211 Quality Trim Threshold: 14.5