EST details — SGN-E278038

Search information 
Request: 278038Match: SGN-E278038
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C73269Clone name: cLER-4-A21
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189688 [TUS-58-H6] Trace: SGN-T339819 EST: SGN-E538944 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C189688 [TUS-58-H6] Trace: SGN-T339822 EST: SGN-E538947 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E278038Length: 580 bp (907 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E278038 [] (trimmed) GGTGAGGCTGTGTGGTTCAAGGTCGGATCCCAAATCTTCAGCGAGGGAGGACTTGACTACTTGGGCAACCCAAGCTTGGTCCATGCACAGAGCAT
CTTGGCCATGTGGGCTTGCCAAGTTGTCTTGATGGGAGCCGTGGAAGGTTACCGTATTGCTGGTGGACCTCTTGGTGAGGTTGTCGACCCACTCT
ACCCCGGTGGCAGCTTCGACCCATTAGGCCTTGCTGAAGACCCCGAGGCATTTGCTGAGCTCAAGGGAAAGGAGATTAATAACGGGAGACTTGCT
ATGTTCTCTATGTTCGGATTCTGTGTTCAGGCCATTGTTACCGGAAAGGGTCCATTGGAGAACCATGCTGACCACCTTTGAGACCCGGATAACAA
CAACGCTTGGGCTTTCGCCACAAACTTTGTCCCCGGAAAATGAATATCATAATATATTGATTGAATTTCGATTGTTTGATGGCCCTGTAAAGTAG
TTGTGACTTCATAGAATGGATTTTTCTTTGAAAATTCCTATGATTGCGTAGTTCTGAGTTACATTTTCCAAAGCTATGAATCAAATATTGCCACT
TTCATACCAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E278038] SGN-U578505 Tomato 200607 Build 2 231 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92871 [Download] [View] Facility Assigned ID: TPRAM11TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.986 Expected Error Rate: 0.0290 Quality Trim Threshold: 12.5