EST details — SGN-E278091

Search information 
Request: 278091Match: SGN-E278091
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C73347Clone name: cLER-4-G16
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189697 [TUS-58-H15] Trace: SGN-T339835 EST: SGN-E538960 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C189697 [TUS-58-H15] Trace: SGN-T339837 EST: SGN-E538962 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E278091Length: 383 bp (762 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E278091 [] (trimmed) AAATCCTGTTATATGGGGTCAGATCATAAAGTTCATCTATTTGAGGAGGTTGCAAAGCACAACAAGACCAAAGATTGTTGGCTTATTATCAGTGG
AAAGGTGTATGATGTGACTCCATTTATGGAAGATCATCCAGGTGGTGATGAAGTTTTGCTTTCAGCAACAGGGAAAGATGCAACAAATGACTTTG
AAGACGTCGGCCACAGTGATTCTGCTAGGGAGATGATGGATAAATATTACATTGGAGATATTGATCAGTCAACAGTTCCTCTAAAACGTGCTTAC
ATTCCTCCAGAACAAGCCCCATACAATCCAGACAAGACTTCAGAATTTGTTATCAAAATTTTGCAAATCCTTGTGCCCCTCTTGATTTTGGGCTT
AGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E278091] SGN-U577361 Tomato 200607 Build 2 68 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92924 [Download] [View] Facility Assigned ID: TPRAN44TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0161 Quality Trim Threshold: 14.5