EST details — SGN-E278119

Search information 
Request: 278119Match: SGN-E278119
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C73363Clone name: cLER-4-H11
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189699 [TUS-58-H17] Trace: SGN-T339841 EST: SGN-E538966 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E278119Length: 253 bp (1010 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E278119 [] (trimmed) TTTGATGCTACTAAGTGCATGTTTTCATGGGGTAATCTCTCTGAGAAGCTTCGGATGGGCCACTTTGATTGCAAAGACGAAGTTATAGTAGATTT
ATTTGCTGGCATTGGATATTTTGTGCTGCCCTTCCTAGTGAGGTGATACTTTTTGTTTTAGAATCACCGTGTTGTTATTTTGTGAATGATGCATT
ATCAAAACCATTTCATTCTCTACCTTTGTGTAAACCTCGAGGGGGGGCCCGGGACCCAAATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E278119] SGN-U565137 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92952 [Download] [View] Facility Assigned ID: TPRAO42TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.939 Expected Error Rate: 0.0049 Quality Trim Threshold: 12.5