EST details — SGN-E278135

Search information 
Request: 278135Match: SGN-E278135
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C73446Clone name: cLER-4-N17
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189709 [TUS-58-I3] Trace: SGN-T339855 EST: SGN-E538980 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C189709 [TUS-58-I3] Trace: SGN-T339858 EST: SGN-E538983 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E278135Length: 514 bp (892 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E278135 [] (trimmed) GCAGTGTGGAAAGCTTTGTGGAGCCAAGGAGATGAGCAAGAAAAAGATAAAGAAGAAGCTTATGAGGTCCTTAAAGTTATCGATAATGAACTTAA
GGACAAGAAGTTTTTTGGGGGAGACAATATCGGATTCGTTGACGTAGTAGCCAATTTTGTCGGATTTTGGATAGGAATTGTTGAAGAAGCCACCG
GGGTTGTACTCGTGACTAGTGAAAATTTTCCTAATTTTTGTGCCTGGAGAGATGAGTATCTTAATTGCGACAGAGTTAAGGAAAATATGCCCTCT
AGAGAAATGTTGCTAGGATATTTTAAGTCTCGAGTTCAAGCTGTAGCGGCTATTTCCAAATGAATATTTAAATACAATTTCCCGTGGTTTTAGTT
TTATACATTTGTAGTGATTTTTTTTGTGCTTTACTTGAGTCGAGAATGTATTAAAAAAGTCTCCATTATATTTTATTGGTGGTTATGTTTTCTTT
TTGAAAATAAAAGTTGTCATTTGGAGAAATATTTGTCTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E278135] SGN-U563898 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92968 [Download] [View] Facility Assigned ID: TPRAO81TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.931 Expected Error Rate: 0.0195 Quality Trim Threshold: 12.5