EST details — SGN-E278597

Search information 
Request: 278597Match: SGN-E278597
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C69401Clone name: cLER-10-B4
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
See unigene SGN-U575006 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E278597Length: 342 bp (723 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E278597 [] (trimmed) TTTGATCCTGATGACTTGTTGACGGGTGCTTTTGATCAAAGTGGTTATATGACTACTACTACTATATCAAGACAGAGGAAAAAGCAGGAACCAGC
GGACATGGCATAGCTAGACCAGAGACTAAGGCGGTTAAATTCCATAAACGCGAGTGATGAACAATAGTTTTGTGATGGAAACCTTATAATTGTAG
TATATATATATATATACATGTTGCATCTCTATCAGGGCATGCTGCCCTTATAGGACATCACAACCCTTGTGCTCATAATGCAATGAGCTAAACAA
CAGCTTGAAGAGTGCTGTTGTGTTTATTTATGTTGATAGATCTTCAAAAGGTGTAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E278597] SGN-U575006 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T94024 [Download] [View] Facility Assigned ID: TPRBN02TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0247 Quality Trim Threshold: 12.5