EST details — SGN-E278778

Search information 
Request: 278778Match: SGN-E278778
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72984Clone name: cLER-2-M22
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C183481 is on microarray TOM1: SGN-S1-1-2.1.1.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183481 [TUS-42-E15] Trace: SGN-T194926 EST: SGN-E393600 Direction: 3' Facility: INRA
Clone: SGN-C183481 [TUS-42-E15] Trace: SGN-T194927 EST: SGN-E393601 Direction: 5' Facility: INRA
Clone: SGN-C183481 [TUS-42-E15] Trace: SGN-T195482 EST: SGN-E394156 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E278778Length: 546 bp (729 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E278778 [] (trimmed) ACACAGAAGGAATGGTCTCTTTTGCTTCAACACTTCCCTCTTTGGTTTCATTCATTCCTTCACCATCTTCCATTACCAATGCCTCAAGAAACCCT
CCTCAACCTGGTATGATTTGTTGTAAGTTTAGATCAGAGCTTAATAATGAAGATCGCTTTCATAGACGTGATATTCTTCAATCTGTTGGAGCAGC
AGTAGGCATGGACTTGATAGCAAGATCGAGTGCATTCATCGAAGTAGCTAATGCTGCTGATTTAATACAACGCAGACAGCGGTCAGATTTTCAAT
CAAAGATCAAACTGACTCTTTATGATGCTATAAAGGCAAATCCGGATATAATTCCATCCTTACTAACTTTAGCACTTAACGATGCCATAACATAT
GATAAGGCAACAAAAACCGGGGGTCCCAATGGATCCATACGTTTCAGCTCAGAGATCAGCAGACCAGAAAATAAGGGGCTTGATGCTGCTTTGAA
TTTGCTGGAGGAATCAAAGAAGGTTATTGATTTAGATTCCAAAGGTGGACCAATCTCATATGCAGATCTCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E278778] SGN-U577581 Tomato 200607 Build 2 30 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92496 [Download] [View] Facility Assigned ID: TPRAF83TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0071 Quality Trim Threshold: 14.5