Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E278907

Search information 
Request: 278907Match: SGN-E278907
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C72987Clone name: cLER-2-M3
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185928 is on microarray TOM1: SGN-S1-1-3.3.7.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E278907Length: 563 bp (864 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E278907 [] (trimmed) TTTTTGTACATCTTTTAATTACCAAAAAAAAAAGAGGAAGAAGATATGGCTTCTAATACATTGATGAGTTGTGGAATTCCAGCTGTTTGCCCCTC
TTTCCTCTCTTCTACCAAGTCCAAATTCGCCGCCGCGATGCCGGTGTCCGTTGGAGCTACCAACTCCATGTCTCGGTTCTCCATGTCAGCTGATT
GGATGCCCGGGCAGCCCCGTCCATCTTACCTCGACGGCTCAGCCCCCGGAGATTTTGGATTTGATCCACTTGGTTTAGGAGAAGTACCTGCAAAT
TTGGAAAGATACAAAGAATCTGAACTTATTCATTGCAGATGGGCTATGCTTGCTGTTCCCGGAATCATAGTACCAGAGGCATTGGGCTTAGGTAA
TTGGGTCAAGGCCCAAGAATGGGCAGCCATTCCTGGTGGACAAGCTACATATTTGGGCCAGCCTGTTCCATGGGGAACACTTCCTACTATTTTGG
CTATTGAATTTCTAGCCATAGCTTTTGTAGAACACCAAAGGAGTATGGAAAAAGATTCAGAAAAGAAGAAGTACCCTGGTGGGGCCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E278907] SGN-U580126 Tomato 200607 Build 2 162 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92625 [Download] [View] Facility Assigned ID: TPRAE74TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0103 Quality Trim Threshold: 14.5