EST details — SGN-E279029

Search information 
Request: 279029Match: SGN-E279029
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C73007Clone name: cLER-2-N22
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C189660 [TUS-58-G2] Trace: SGN-T339771 EST: SGN-E538896 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C189660 [TUS-58-G2] Trace: SGN-T339774 EST: SGN-E538899 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E279029Length: 441 bp (559 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E279029 [] (trimmed) CTCTCTTTGGAGTTCGAAATGGTCGGTCCATTGCTTCGATCTCTCTGGTCTACCACTAGGAGATCCTTCTCCTCCTCTCATTATTCTCATATCAA
ACCTTTATCCTATGCTCGAGCTTTCTCCACCGCCACAGCTACCGCCCCCGTTGGCTCCGCCGCCACAGCACCCGGCGGCGCTCTGGATCCTGGCC
GGCTCAGGAATGTCGCGGTTATAGCTCACGTCGATCATGGAAAGACTACTCTCATGGATAGGCTGCTTCGTCAGTGCGGCGCTGATATACCTCAC
GAGCGTGCCTTAGACTCTATTGACCTCGAACGAGAGCGCGGCATCACTATTGCTTCTAAGGTTACATCCATCTCGTGGAAGGACAAAGAGCTAAA
CATGGTGGACACTCCTGGACACGCAGATTTTGGTGGTGAAGTTGAGAGGGTTGTTGGCATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E279029] SGN-U580723 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92747 [Download] [View] Facility Assigned ID: TPRAH83TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0007 Quality Trim Threshold: 14.5