EST details — SGN-E279052

Search information 
Request: 279052Match: SGN-E279052
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C59054Clone name: cLEL-4-I19
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C59054 [cLEL-4-I19] Trace: SGN-T16282 EST: SGN-E229376 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E279052Length: 401 bp (955 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E279052 [] (trimmed) GGTGGCTACTATCCTCACCCTCCAAGTACACCTACACCTACACCTAGTACCCCATCCACACCCACTATTGTAACCCCACCAACTACTCCTATCAT
TGACCCTGGCACTCCAAGCACTCCTGCTACCCCAACACCATCACCTCCTTTTACATGCGATTACTGGAGGACTCACCCAGGACTGATATGGGGCT
TGTTTGGTTGGTGGGGAAATGTTGGTAGTGCATTTGGCGTGGCTAGTGCTCCAGGGCTCGGCTCAAACATGAACTTGCTGCAAGCACTTTCAAAC
CAACATACCGATGGATTTGGGCAACTCTACAGGGAAGGCACAGCTTCTTTGCTGAACTCCATGGTTAGCAAGAGGTTCAGTTACAGCACCACCCA
AGTCAAGAACAATTTTGCTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E279052] SGN-U567505 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T21502 [Download] [View] Facility Assigned ID: tomato040158.t3
Submitter: Koni Sequencing Facility: Novartis
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0062 Quality Trim Threshold: 14.5