Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E279090

Search information 
Request: 279090Match: SGN-E279090
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C59055Clone name: cLEL-4-I2
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E279090Length: 376 bp (1113 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E279090 [] (trimmed) CCGAATCACCCTAACCCTACCTCTGACATTGAAACCCCCACCACTTTTACTCCCTCTGACGACAACTTCCTCCTCAATAGTCCTTATCTCCACCG
TCTAATTCGCCATCTCACCACCACTAATGACGCTCCTACCCCCAATCTTCACAACAATTCCGCGTCCAGATCAGCTGTGGCGGCACTTGAACTAC
TTCAAATTACCTCTTCCATGCTTGAGAATGATCCGGTTATTCTTTGTGCGGTCTGCAAAGACCAGTTTTTACTCGACATGCAAGTTAAAATGTTG
CCTTGCAAACACATGTATCATTCTGATTGTATTTTACCATGGTTAGAAATGAATAATTCATGTCCCAGTTGTTAGGGTTCCAGTTACCTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E279090] SGN-U572525 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T21576 [Download] [View] Facility Assigned ID: tomato040249.t3
Submitter: Koni Sequencing Facility: Novartis
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0070 Quality Trim Threshold: 14.5