EST details — SGN-E279386

Search information 
Request: 279386Match: SGN-E279386
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C69540Clone name: cLER-11-D5
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185347 is on microarray TOM1: SGN-S1-1-8.3.9.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185347 [TUS-47-C9] Trace: SGN-T192054 EST: SGN-E390728 Direction: 5' Facility: INRA
Clone: SGN-C185347 [TUS-47-C9] Trace: SGN-T192297 EST: SGN-E390971 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E279386Length: 597 bp (874 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E279386 [] (trimmed) AAAAAGCAACATTCTTGAGACAAAAAAGATTCTTGCTTTGAGGAATTGGTTGCAAAAATGGCGACAATCACAGCGGGTATAAGCCTCAGAGGACC
AGTAGTGGGTGGTTACAGGACATTTGCAGTGACCAAAAGGGCTTTACCCAAGGTGAAATTCAGCTCAGAGTTGAGTTTTGTGACTTCTCAATTGA
GTGGCATCAAGATTTCAAGCACCCATTTGAGCTCTCCTGCTTCACTTTCTGTTCCTTTCAAGACAGCCCTTCAACCTGTTGCTCGTAGAGTATGC
CCCTTCACTGGCAAGAAGTCCAACAGGGCAAACAAGGTCTCTCATTCAAACCACAAAACGAAAAAGTTGCAATTCGTAAACCTTCAATACAAGAG
AATTTGGTGGGAGGAAGGCAAACGATTCGTGAAACTGAGGTTGTCAACAAAGGCCATAAAGACCATTGAGAAAAATGGACTTGATGCTGTAGCCA
AGAAAGCTGGGATTGATCTCAGCAAGAAGTAGAACCTGGAACCTGATAGCATATTTGTTTGGACACTAATTTTGATGCCCTCAAAAACCATAACT
TTATTTTTTGGCATTGCTTGTTGATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E279386] SGN-U582646 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T94138 [Download] [View] Facility Assigned ID: TPRBQ15TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0196 Quality Trim Threshold: 12.5