EST details — SGN-E279427

Search information 
Request: 279427Match: SGN-E279427
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C69516Clone name: cLER-11-B19
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E279427Length: 543 bp (848 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E279427 [] (trimmed) GGTTCCGTCACCAGATCACTTACTTCCGTCGCTAGAGCTTCCACTTCCCGTTCATCTCCGACCGTTAACCGCGTTCGCACTCCTCCGATCTCCGG
CACTCGTTCCAACACGCGCCGCTTCTCATTCACCAGTCCCAGGACATTGGGAGCTTTGGGGTGTACTCAGTCATTTTTGCCTCTGCATAATGTGG
TGGCTGGAACTCGATTGACTTCTCACTTGACAGTTAATGTGCGGGCTTGCTGCGAGCTGTATCATGGTACTTGAACACAATTAATGGAACAGCAC
AAAGTTGCTTGAGGTTTATGGTAGTCTTGGCGGGTTGATGCATCTCTGACAATCTGTTTTGGATGCAGAAAATAATAACTGTAATCTTTGTTTTT
TCACATTCTAAAGATAAACTAGAAAATCTGTTTCCGACAGTATCATAGAGATTAAATTTATTTCAGTTAAGTGTTCATTTATATGCTTGGCCCAT
CTTATGTAAGCCATTTAAGATGCTTATTAAACATCCTTTCTTCCGCAATCTAATATGATGTTAGAGTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E279427] SGN-U566437 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T94179 [Download] [View] Facility Assigned ID: TPRBQ10TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0099 Quality Trim Threshold: 12.5