Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E279489

Search information 
Request: 279489Match: SGN-E279489
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C73680Clone name: cLER-5-K5
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E279489Length: 387 bp (1040 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E279489 [] (trimmed) TCGGGTTCACCTGCAAAGATAAAGGAGTTGAGGACAAAGGAGATTAAGAACGGTAGACTTGCTATGTTAGCCGTTATGGGTGCATGGTTCCAACA
CATTTACACTGGAACAGGCCCTATTGATAACCTATTTGCTCACCTAGCTGATCCTGGTCATGCCACTATTTTTGCTGCATTCAGTCCCAAGTGAG
AAGCAGAAGCAGAACACCTTTTGTTGTAATGATGTGTAAAAGTAACATTTGAAGTAGATTTGTGCAAAGAAAAACTTTAATGTTTCTTTTGCCAC
TCAATGTAGTATACCTACATTTGGTTTGCCCTCCTGTAGAAAAAGACTCAGTGTACAAATACCTTTGAGAATTCGTGTCAGATCAAAAAAATCTA
TTTATAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E279489] SGN-U579101 Tomato 200607 Build 2 271 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92998 [Download] [View] Facility Assigned ID: TPRAQ63TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0020 Quality Trim Threshold: 12.5