Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E279686

Search information 
Request: 279686Match: SGN-E279686
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C73531Clone name: cLER-5-D1
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C184321 is on microarray TOM1: SGN-S1-1-2.4.16.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184321 [TUS-44-H15] Trace: SGN-T198290 EST: SGN-E396964 Direction: 3' Facility: INRA
Clone: SGN-C184321 [TUS-44-H15] Trace: SGN-T198291 EST: SGN-E396965 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E279686Length: 566 bp (841 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E279686 [] (trimmed) TGTAGGGAGTGCTGCTATTGAACCGCTTTCTTGGGACTTGCGGCTCAAAATTGCCATAGGAGCAGCACGGGGCTTAGCGTTCTTACATACTTCAG
AAAAGAAAGTTATTTACAGAGACTTCAAAGCCTCAAACATACTGCTTGATGGGAATTACAATGCAAAAATATCAGATTTTGGCTTAGCTAAGTTG
GGGCCTTCCGGTAGTAACTCACACGTAACTACTCGTGTGATGGGCACATATGGTTATGCTGCTCCAGAATATGTTGAAACTGGTCATCTATATGT
AAAAAGTGATGTTTACGGATTTGGAGTGGTCGTGCTTGAGTTGCTGACTGGTTTACGAGCCCTCGACACCAAAAGACCAAACAGACAAGAGAAAT
TGGTGGACTGGGTGAAACCGATGCTGTCTAACAAAAGGAAGCTGAAGTCCATTATGGATGCTCGGATGGAAGGCCAATATTCTTCAAAAGCAGCA
ACCCTTGCTGCTCAGATTACTCTAAAATGTCTAGAGGTAGACCCAAAGAATCGACCTTCAATGAAAGAAGTAATGAACGTGTTGGAACAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E279686] SGN-U581802 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T93195 [Download] [View] Facility Assigned ID: TPRAS13TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0077 Quality Trim Threshold: 14.5