Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E279724

Search information 
Request: 279724Match: SGN-E279724
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C73532Clone name: cLER-5-D10
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E279724Length: 316 bp (678 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E279724 [] (trimmed) CAGATAATAAAAATCCACCATTTTCTCTTCTTATCCTTTTTTTTTTTAATTATTGTGAAAAAAAATCTAAAATTTGGTGTAAAAATGGCTGGAAA
TGGAGTATTTGCAGAAATAATTGATGGAGAAGTGTACAAATATTATTGTGAATGAGAATGGAAAAAATCAGCTTCTGGAAAATCTGTCGCTATTA
TTAATCCTACTACAAGAAAGACACAATACAAAGTTCAAGCATGTTCACAAGAAGAGGTGAACAAAGTTATGGTAATTTCAAAAGCCGCACAAAAA
TCATGGGCTAAAACACCACTATGGAAAAGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E279724] SGN-U577789 Tomato 200607 Build 2 69 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T93233 [Download] [View] Facility Assigned ID: TPRAT17TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.921 Expected Error Rate: 0.0239 Quality Trim Threshold: 14.5