Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E279843

Search information 
Request: 279843Match: SGN-E279843
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C74293Clone name: cLER-8-J21
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C182547 is on microarray TOM1: SGN-S1-1-8.2.7.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E279843Length: 546 bp (638 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E279843 [] (trimmed) CTCTTCTCACTTCTTCCCCAATTTCTTTCAAATCCCAATCCTCACTCTTATCCTTCTCCGCCATGGCTTCAATTTCAGCAGCGGCTGCCACCGCC
ACTTCTTCTCCTAAGCTCCTAAACCCTTCTAATCCCCTTCTTCCTTCCGCTGCTAAACCATCTAAGCTTATCCTATCCTCTTCATTTACCCCCAA
CTTTTCTACCCTTCTCCTCCACTCACCCGCCGCTACTTCTCCCACTACCCACCACCAACGCCGCTTCACTGTCCGTGCTGCCCGTGGCAAATTCG
AGAGGAAGAAACCCCATGTCAATATTGGCACTATTGGTCATGTTGACCATGGAAAGACTACCCTTACTGCTGCTTTAACCATGGCTCTTGCTTCT
ATGGGTAATTCCGCTCCCAAGAAGTATGATGAAATTGATGCCGCCCCAGAAGAGCGTGCTCGTGGGATTACTATTAATACGGCTACGGTTGAGTA
TGAGACTGAGAACCGACACTATGCCCACGTGGACTGCCCCGGTCACGCTGATTATGTCAAGAACATGATTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E279843] SGN-U578104 Tomato 200607 Build 2 50 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T93745 [Download] [View] Facility Assigned ID: TPRBE59TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0070 Quality Trim Threshold: 14.5